BXG, عضو في منتدى أجنبي وجد رقم يطابق الرقم الذي كتب في أول صورة فنيةلـ MGS4.. و الأمر يتعلق بالجينات أيضا! ..
الـــــــصــــــــورةThe number of that bar-code is: 64654474 464...
I have found the same number on TCFAG's (The Centre For Applied Genomics) site...
Link:
http://projects.tcag.ca/cgi-bin/dupl...id=dp_7_7_3624
(ctrl+f) to find the number...
~~~
A stands for adeninechr7 : 64654415 ctcagcctcccgaatagttgggattacaggcgattctgttgcctcatcctcccaagtagc 64654474
||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||
T stands for thymine
G stands for guanine
C stands for cytosine
"The instructions in a gene that tell the cell how to make a specific protein. A, T, G, and C are the "letters" of the DNA code; they stand for the chemicals adenine, thymine, guanine, and cytosine, respectively, that make up the nucleotide bases of DNA. Each gene's code combines the four chemicals in various ways to spell out 3-letter "words" that specify which amino acid is needed at every step in making a protein."
الترجمة لاحقا.. تعليقاتكم ؟؟
و... جاري البحث عن 23.006300..
تحرير:
الشفرة: 64654474 464...
وجدت الرقم نفسه في موقع TCFAG (مركز التطبيقات الجينية).
الرابط:
http://projects.tcag.ca/cgi-bin/dup...&id=dp_7_7_3624
إضغط CTRL+F لتجد الرقم.
~~~
إقتباس:
chr7 : 64654415 ctcagcctcccgaatagttgggattacaggcgattctgttgcctcatcctcccaagtagc 64654474 ||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||
A تعني أدنين
T تعني ثيمين
G تعني جونين
C تعني سايتوسين
Soliden: و هذه هي قواعد الأحماض النووية.
الأوامر التي تخبر الجين كيف يصنع البروتين المعين هي A,T,G,C. و هي حروف شفرات الـ DNA.إنها اختصارا للموالد الكيميائية التالية: أدنين, ثيمين, جونين, سايتوسين. على التوالي, و التي تصنع قواعد النيوكلوتيدات للـ DNA.كل شفرة جين تضم الأربعة المواد بطرق مختلفة لتقرأ ثلاثة حروف "كلمات" و التي تحدد أي حمض أميني مطلوب في كل خطوة لصنع بروتين..